Strain Information | |
---|---|
Image | |
BRC No. | RBRC09858 |
Type | CRISPR/Cas9 |
Species | Mus musculus |
Strain name | B6D2-Dnajb13<em1Osb> |
Former Common name | Dnajb13<-2/wt> |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Taichi Noda and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. BDF1 background. |
Strain description | Dnajb13 mutant mice generated by the CRISPR/Cas9 technique. 2 bp deletion.Dnajb13<em1Osb>, [Deleted sequence]:TAGAGATAGTCTGTTGTGAGATGTCAGGAGCAGAAGGACCTTAGAGGTCGCAAAGCCCTGCCTCCTGTTGCCAAGATGGAAGCAAGAAACTCTGAAGCCTCAGGGAACAGTCTGTGCCTAGGAAGGCAAAATGGGGCCTTGGGTGCCTAGCTTTTGGGGTCCTGCAGGAAGCATCCCTCCAACTCACTTCCCATCATAGCTATAGGATAGGAATCTTTATTATGTCAGCCTAAGGTCTCACGCCTCCCCATCTTCATAGGCTGTGGGAGTTGAGTGGATAGGAGCAGGCAAGGCCCAGCTAGCCCTCTCCATCCCTGTTCCTGCTCAGGTCCCCCAGAATTAGGTCAGCAATGCCTGGCGCAGCATCTGCTTCTTCTGGGGTGTGAGGCGGGTGGGGAACTGGATGTCAAAGAAGATGAAGAGGTCTCCCTTC[TT]GCTGGGGTTCTCAGGCAGTGGCATCCCCTCACCTGGCACAATCTTGAAGTACTTAGGGctgagacagggaaagaagaaaggaaggagcatagatgactcagcagtgtcggatgggtgcacgctacttcctgcacacttgcaggagcctcagccattcttacagcttcccactagctggccaggtctcacacaccagagc |
Colony maintenance | |
References | Sci. Rep., 6:31666 (2016). 27530713 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Dnajb13DnaJ heat shock protein family (Hsp40) member B137Dnajb13<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
Ordering Information | |
---|---|
Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of Dnajb13 gene |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci Rep. 2016 Aug 17;6:31666. doi: 10.1038/srep31666.RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen sperm |
Strain Availability | Recovery and QC required prior to distribution |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |