Strain Data Sheet

RBRC10014

Strain Information

Image
BRC No.RBRC10014
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameB6D2;B6-Plcz1<em1Osb>
Former Common namePlcz1-50827/wt
H-2 Haplotype
ES Cell lineEGR-G101 [C57BL/6NCr-Tg(CAG/Acr-EGFP)C3-N01-FJ002Osb]
Background strain
Appearance
Strain developmentDeveloped by Kaori Nozawa and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were crossed to BDF1. Mixed genetic background.
Strain descriptionPlcz1 mutant mice. Deletion of 50827 bp genomic fragment around the Plcz1 gene.Plcz1<em1Osb>; 50827 bp deletion.AAAAGCGGTAGCAGCGAGAACAGCTGATGACGGTCACAAAAAGACAGTGTTACTTCTAAGACAAGTGACACCTTAGA-(50827 bp deletion)-CGAACCTTGAACCTTCCTCACTGTTTATTTATGTTTGGTACTTCAGAGAG
Colony maintenance
ReferencesSci. Rep., 8(1):1315 (2018). doi: 10.1038/s41598-018-19497-6. 29358633

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Plcz1phospholipase C, zeta 16Plcz1<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized)*, crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of Plcz1 gene* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). E. coli Ampicillin resistance gene was not detected by PCR. Other introduced genes were not tested.
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci. Rep. 2018 Jan 22;8:1315. doi:10.1038/s41598-018-19497-6 In case RECIPIENT publishes the results of his or her research using BIOLOGICAL RESOURCE prior to the publications on the BIOLOGICAL RESOURCE by DEPOSITOR, RECIPIENT agrees to share authorship of such publication with DEPOSITOR.  RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen embryosFrozen embryos
an icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP
Genotyping protocol -PCR-

BRC mice in Publications

Hirose N, Kikuchi Y, Kageyama A, Sugita H, Sakurai M, Kawata Y, Terakawa J, Wakayama T, Ito J, Kashiwazaki N.
Successful Production of Offspring Derived from Phospholipase C Zeta-Deficient Sperm by Additional Artificial Activation.
Life (Basel) 13(4) (2023) 37109509