Strain Data Sheet

RBRC09824

Strain Information

Image
BRC No.RBRC09824
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameB6D2;B6-Ube2d2b<em1Osb>
Former Common nameUbe2d2b <-397/-397>
H-2 Haplotype
ES Cell lineEGR-G101 [C57BL/6NCr-Tg(CAG/Acr-EGFP)C3-N01-FJ002Osb]
Background strain
Appearance
Strain developmentDeveloped by Asami Oji and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. Mixed genetic background. EGR-G101 ES cell was used. Mice were crossed with B6D2.
Strain descriptionTktl1 mutant mice generated by the CRISPR/Cas9 technique. Ube2d2b<em1Osb> [Deleted sequence]: 397 bp deletion at Exon 1. aggccagaactgcctgcctcctcttctgcggctgatccaaaaccagcaaggcagccccaggccctcggtgcctgcctccttccacctggggcctaccaagacagccttccaccatggctctgaagagaatccacaa[ggaactgaacgacctggcccaggatcccccagcacagtgttcagcaggtcctgtcggggaagatatgtttcactggcaagctacaatcatggggccaaatgatagtccctatcagggcggagcatttttcttgacaattgatttcccaacagagtaccccttcaaaccacctaaggttgaatttacaacaagaatttatcatccaaatgttaacagtaacggcagtatttgtcttgatattcttcggtcacagtggtctccagcactaactatttccaaagtacttttgtccatcagttctctgttgtgtgaccccaatccagatgatcccttagtgcctgagattgctcagatctacaaaacagatagagacaagtacaacagaacagctcgggaa]tggactcagaaatatgcgatgtgactaaagagaatactggatatcctctacaaataaaagctaggggaactctgaaagagaagttcttttgattcccaccggactgtttcccatg
Colony maintenance
ReferencesBiol. Reprod., 101(2):501-511 (2019). 31201419

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Ube2d2bubiquitin-conjugating enzyme E2D 2B5Ube2d2b<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of Ube2d2b gene, jellyfish GFP cDNA
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Biol. Reprod., 101(2):501-511 (2019).RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP
Genotyping protocol -PCR-

BRC mice in Publications

No Data