Strain Data Sheet

RBRC09843

Strain Information

Image
BRC No.RBRC09843
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameSTOCK Del(9Gm17677-Gm17689)1Osb
Former Common namePateN-G<-841 kb/wt>
H-2 Haplotype
ES Cell lineEGR-G01 [129S2 x C57BL/6NCr-Tg(CAG/Acr-EGFP)]
Background strain
Appearance
Strain developmentDeveloped by Taichi Noda and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. EGR-G01 ES cell was used to generate chimera mice. Mice were further crossed with B6D2F1. Mixed genetic background.
Strain descriptionMutant mice generated by the CRISPR/Cas9 technique. 841 kb deletion at chromosome 9.Del(9Gm17677-Gm17689)1Osb, [Deleted sequence]:AGGAGTACTGATTTTGTACAAGT[ctcattcaatgggtgagtgtaat (about 841 kb deletion) caggagtatcaagaggtattttccaattgcagt]GGGATCCTAGGAG
Colony maintenance
ReferencesProc. Natl. Acad. Sci. USA, 116(37):18498-18506 (2019). doi:10.1073/pnas.1908736116. 31455729

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Gm17677predicted gene, 176779Gm17677

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Gm17689predicted gene, 176899Gm17689

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of PateN-PateG gene, jellyfish GFP cDNA
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18498-18506. doi: 10.1073/pnas.1908736116.RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP

BRC mice in Publications

No Data