Strain Information | |
---|---|
Image | |
BRC No. | RBRC09845 |
Type | CRISPR/Cas9 |
Species | Mus musculus |
Strain name | B6D2-1700019N19Rik<em1Osb> |
Former Common name | 1700019N19Rik<-50/-50> |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Masashi Mori and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2014. BDF1 background. |
Strain description | 1700019N19Rik mutant mice generated by the CRISPR/Cas9 technique. 50 bp deletion at Exon 3.1700019N19Rik<em1Osb>, [Deleted sequence]:AAAGCTCCAGCG[AGGACCGCATGAATCCCTGTGTGAAAGCGTTCCAGGAGAGAACGCAGAGA]TACAAGGAGG |
Colony maintenance | |
References | Proc. Natl. Acad. Sci. USA, 113(28):7704-10 (2016). 27357688 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter 1700019N19RikRIKEN cDNA 1700019N19 gene191700019N19Rik<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
Ordering Information | |
---|---|
Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of 1700019N19Rik gene |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci. USA, 113(28):7704-10 (2016). RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen sperm |
Strain Availability | Recovery and QC required prior to distribution |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |