Strain Data Sheet

RBRC09957

Strain Information

Image
BRC No.RBRC09957
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameB6D2-Col20a1<em1Osb>
Former Common nameCol20a1<+4/+4>
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Daiji Kiyozumi and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. Fertilized eggs derived from BDF1×BDF1 were used. Mixed genetic background.
Strain descriptionCol20a1 mutant mice generated by the CRISPR/Cas9 technique. 4 bp insertion at exon 2.Col20a1<em1Osb>: 4 bp insertion at exon 2.ggtcactggtaagtctgccttataccccaacttccaatcctgttgttacagTAAGTAGCCGC(AGTA)CTGAGGCTGGCAGTACTGCCTGAGGACCAGCTGCAGAT
Colony maintenance
ReferencesProc. Natl. Acad. Sci. USA, 113(28):7704-10 (2016). 27357688

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Col20a1collagen, type XX, alpha 12Col20a1<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of Col20a1 gene, human hU6 promoter
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci. USA, 113(28):7704-10 (2016). RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP
Genotyping protocol -PCR-

BRC mice in Publications

No Data