Strain Information | |
---|---|
Image | |
BRC No. | RBRC10096 |
Type | CRISPR/Cas9 |
Species | Mus musculus |
Strain name | C57BL/6J-Hr<em1Utr> |
Former Common name | Hrem1Utr/em1Utr |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Fumihiro Sugiyama and his colleague, Laboratory animal resource center, University of Tsukuba in 2014. With the CRISPR/Cas9, 5 bp deletion was introduced into exon 3 of Hr (hairless) gene. C57BL/6J genetic background. |
Strain description | Mutant strain harboring c.63_67delCGGCA mutation in the Hr (hairless) gene. Homozygous mutant shows the hairless phenotype starting around 3 weeks old. Hr<em1Utr>; 5 bp deletion at exon 3AGCCCCTGTGAACGGCATTGTGGG |
Colony maintenance | |
References | Exp. Anim., 66(4):437-445 (2017). 28717054 |
Health Report | |
---|---|
Examination Date / Room / Rack | 2024/02/26Room:4-BRack:G 2023/11/27Room:4-BRack:G 2023/08/28Room:4-BRack:G 2023/05/29Room:4-BRack:G 2023/02/27Room:4-BRack:G 2022/11/29Room:4-BRack:G 2022/05/09Room:2-検Rack:C |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Hrhairless14Hr<em1Utr>endonuclease-mediated mutation 1, University of Tsukuba Laboratory Animal Resource Center |
Ordering Information | |
---|---|
Donor DNA | pX330-U6-Chimeric_BB-CBh-hSpCas9[human U6 promoter, S. pyogenes gRNA scaffold, human U6 terminator, CMV,chicken hybrid CMV enhancer/chicken beta-actin promoter (CBh), Synthetic DNA 3xFLAG, SV40 nuclear localization signal(NLS), Streptococcus pyogenes SpCas9* (human codon-optimized), bovine GH polyA signal, AAV2 inverted terminal repeat (ITR), f1 phage f1 origin, E. coli pUC origin]* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). E. coli Ampicillin resistance gene was not detected by PCR. Other introduced genes were not tested. |
Research application | |
Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Exp Anim. 2017 Jul 18. doi: 10.1538/expanim.17-0049. |
Depositor | Fumihiro Sugiyama (University of Tsukuba) |
Strain Status | Live mice Frozen embryos Frozen sperm |
Strain Availability | Cryopreserved sperm (within 1 month) Cryopreserved embryos (within 1 month) Live mouse (3 to 6 months) |
Additional Info. | Mouse of the Month Feb 2020 Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |