Strain Data Sheet

RBRC10246

Strain Information

Image
BRC No.RBRC10246
TypeTargeted MutationCartagena
SpeciesMus musculus
Strain nameB6.129P2-Avil<tm2(cre)Faw>
Former Common nameAdvillin-Cre mice, B6.129P2-Avil<tm2(cre)Faw>
H-2 Haplotype
ES Cell lineE14 [129P2/OlaHsd]
Background strain
Appearance
Strain developmentThe line SHOULD be maintained as male heterozygous, homozygous or female advillin-Cre mice have leaky Cre expression.E14 ES cells were used to generate this strain, and then mice were crossed to C57BL/6J.Number of backcrossing to C57BL/6J:unknown.
Strain descriptionCre was knocked into exon 2 of the Avil locus.
Colony maintenance
ReferencesProc. Natl. Acad. Sci. USA, 107(20), 9424-9429 (2010). 20439739

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Aviladvillin10Avil<tm2(cre)Fawa>targeted mutation 2, Fan Wang

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
EGFPEnhanced Green Fluorescent Protein (Aequorea victoria)10EGFP

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Flpyeast flippase recombinase10Flpmouse Ace promoter

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
FrtFrt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)10Frt

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
FrtFrt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)10Frt

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
GHGrowth hormone polyA (Bovine)10GH

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Iresinternal ribosomal entry site (EMCV)10

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
crePhage P1 Cre recombinase10cre

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
neoneomycin resistance gene10mouse Polr2a promoter

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
HSV thymidine kinase polyA signal10

Ordering Information

Donor DNAPhage P1 Cre recombinase, Encephalomyocarditis virus (EMCV) internal ribosomal entry site (ires), jellyfish GFP cDNA, Bovine Growth Hormone polyA, mouse Ace genomic DNA, yeast Flp cDNA, HSV thymidine kinase polyA signal, mouse Polr2a promoter, E. coli Neomycin resistance gene, mouse Avil genomic DNA, yeast Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)
Research applicationCre/loxP system
FLP/frt system
Fluorescent Proteins/lacZ System
Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci., U S A, 107(20), 9424-9429(2010).The BIOLOGICAL RESOURCE is solely for research use by nonprofit institutes only. The RECIPIENT of a for-profit organization must first obtain a use license from the DEPOSITOR. Depositor shall notify RIKEN BRC of its written consent within (10) days of execution of any use license for the BIOLOGICAL RESOURCE. It shall be the sole responsibility of Depositor to obtain and enforce any use licenses.
DepositorFan Wang (Duke University)
Strain Statusan icon for Frozen embryosFrozen embryos
an icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved embryos (2 to 4 months)
Cryopreserved sperm (within 1 month)
Cryopreserved embryos (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Order form (Japanese / English)
  2. Category I MTA: MTA for distribution with RIKEN BRC (Japanese / English)
  3. Acceptance of responsibility for living modified organism (Japanese / English)

Genotyping protocol -PCR-

BRC mice in Publications

No Data