Strain Information | |
---|---|
Image | |
BRC No. | RBRC10354 |
Type | CRISPR/Cas9 (Transgene) |
Species | Mus musculus |
Strain name | B6D2-Cetn1<em6Osb> |
Former Common name | Cetn1-8/wt |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Taichi Noda and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2017. Fertilized eggs derived from BDF1 × BDF1 were used to generate this line. Mixed genetic background. Homozygous males are infertile. |
Strain description | Cetn1<em6Osb>; 8 bp deletion at exon 1TCACACACGTGCGATGTCAGGGCACCGTTAAGATCCCAACTGTTGTGGAGGATGGCGTCCACCTTCAGGAAGTCAAACGTTGCCTCTACCAGCTACAAGAGAAAGGTGGGTCCTAAGCCTGAACTCACCGAAGATCAAAAGCAAGAAGTTCGGGAAGCCTTTGACCTCTTCGATTCTGATGGGAGCGGGACCATCGATGTGAAGGAGCTGAAGGTGGCCATGAGAGCACTTGGCTTTGAACCCAGGAAGGAAGAGATGAAGAAAATGATTTCAGAAGTAGACAAAGAGGCCACAGGAAAGATCAGCTTCAATGACTTCTTGGCTGTGATGACTCAGAAGATGGCCGAGAAAGATACCAAAGAGGAAATCCTGAAGGCTTTCAGGTTGTTTGATGACGACGAAACTGGGAAAATTTCATTCAAAAACCTCAAGCGTGTGGCCAATGAGCTGGGGGAAAGCCT |
Colony maintenance | |
References | Sci. Rep., 3:3355 (2013). doi: 10.1038/srep03355 24284873 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Cetn1centrin 118Cetn1<em6Osb>endonuclease-mediated mutation 6, Research Institute for Microbial Diseases, Osaka University |
Ordering Information | |
---|---|
Donor DNA | Streptococcus pyogenes crRNA, tracrRNA, Mouse a part of Cetn1 gene |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen sperm |
Strain Availability | Recovery and QC required prior to distribution |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |