Strain Information | |
---|---|
Image | |
BRC No. | RBRC10387 |
Type | CRISPR/Cas9 (Transgene) |
Species | Mus musculus |
Strain name | C57BL/6-Pld2<em1Yaka> |
Former Common name | PLD2-KO (CRISPR/Cas9) |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Yasunori Kanaho and NGO THAI BICH VAN, University of Tsukuba in 2016. This strain was generated using fertilized eggs derived from C57BL/6J with the CRISPR/Cas9. |
Strain description | Pld2 (phospholipase D2) mutant mice generated by the CRISPR/Cas9. Stop codon was introduced at Exon 3 of the Pld2 gene. Pld2<em1Yaka>:gcctctgaaagcacaccccttggtgttcg(AATTCGACTACAAAGACGATGACGACAAGTGATTGACTAGG)cccctggggtccctgttat |
Colony maintenance | |
References | Sci. Rep., 8(1) 6283 (2018). 29674728 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter FLAGFLAG tag (synthetic)11FLAG |
Ordering Information | |
---|---|
Donor DNA | pX330-U6-Chimeric_BB-CBh-hSpCas9[human U6 promoter, S. pyogenes gRNA scaffold, human U6 terminator, CMV,chicken hybrid CMV enhancer/chicken beta-actin promoter (CBh), Synthetic DNA 3xFLAG, SV40 nuclear localization signal(NLS), Streptococcus pyogenes SpCas9 (human codon-optimized), bovine GH polyA signal, AAV2 inverted terminal repeat (ITR), f1 phage f1 origin, E. coli Ampicillin resistance gene (AmpR), E. coli pUC origin], FLAG tag sequence (synthetic) |
Research application | |
Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci. Rep., 8(1), 6283 (2018).In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit institution for a not-for-profit research. |
Depositor | Yasunori Kanaho (University of Tsukuba) |
Strain Status | Frozen embryos Frozen sperm |
Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |